| |
|
|
|
Registro Completo |
|
Biblioteca(s): |
Embrapa Hortaliças. |
|
Data corrente: |
23/04/2004 |
|
Data da última atualização: |
23/04/2004 |
|
Autoria: |
GONÇALVE, M. E. de C.; BLEICHER, E.; SILVA, L. D. da; FREITAS, J. D. B. de. |
|
Título: |
Uso do sabão no controle da mosca-branca em meloeiro. |
|
Ano de publicação: |
2003 |
|
Fonte/Imprenta: |
Horticultura Brasileira, Brasília, v. 21, n. 2, jul. 2003. Suplemento 2. |
|
Idioma: |
Português |
|
Notas: |
Trabalho apresentado no 43º Congresso Brasileiro de Olericultura, 2003. Publicado também como resumo em: Horticultura Brasileira, Brasília, v. 21, n. 2, p. 333, jul. 2003. Suplemento 1. |
|
Palavras-Chave: |
Controle alternativo; Mosca-branca. |
|
Thesagro: |
Cucumis Melo; Inseto; Melão; Praga; Sabão. |
|
Thesaurus Nal: |
Bemisia argentifolii. |
|
Categoria do assunto: |
-- |
|
Marc: |
LEADER 00869naa a2200253 a 4500
001 1775887
005 2004-04-23
008 2003 bl uuuu u00u1 u #d
100 1 $aGONÇALVE, M. E. de C.
245 $aUso do sabão no controle da mosca-branca em meloeiro.
260 $c2003
500 $aTrabalho apresentado no 43º Congresso Brasileiro de Olericultura, 2003. Publicado também como resumo em: Horticultura Brasileira, Brasília, v. 21, n. 2, p. 333, jul. 2003. Suplemento 1.
650 $aBemisia argentifolii
650 $aCucumis Melo
650 $aInseto
650 $aMelão
650 $aPraga
650 $aSabão
653 $aControle alternativo
653 $aMosca-branca
700 1 $aBLEICHER, E.
700 1 $aSILVA, L. D. da
700 1 $aFREITAS, J. D. B. de
773 $tHorticultura Brasileira, Brasília$gv. 21, n. 2, jul. 2003. Suplemento 2.
Download
Esconder MarcMostrar Marc Completo |
|
Registro original: |
Embrapa Hortaliças (CNPH) |
|
|
Biblioteca |
ID |
Origem |
Tipo/Formato |
Classificação |
Cutter |
Registro |
Volume |
Status |
URL |
Voltar
|
|
|
Registro Completo
|
Biblioteca(s): |
Embrapa Unidades Centrais. |
|
Data corrente: |
02/05/2001 |
|
Data da última atualização: |
25/02/2019 |
|
Autoria: |
ANUNCIACAO, C. E.; ASTOLFI FILHO, S. |
|
Afiliação: |
CARLOS EDUARDO ANUNCIAÇÃO, Universidade Federal de Goiás - UFG/Departamento de Ciências Fisiológicas; SPARTACO ASTOLFI-FILHO, Universidade de Brasília - UnB/Departamento de Biologia Celular/Laboratório de Biologia Molecular. |
|
Título: |
Paternity test in "mangalarga-marchador" equines by DNA-fingerprinting. |
|
Ano de publicação: |
2000 |
|
Fonte/Imprenta: |
Pesquisa Agropecuária Brasileira, Brasília, DF, v. 35, n. 10, p. 2007-15, out. 2000. |
|
Idioma: |
Inglês |
|
Notas: |
Título em português: Teste de paternidade em eguinos Mangalarga-Marchador pela técnica do DNA 'fingerprinting". |
|
Conteúdo: |
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 105-fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively. |
|
Palavras-Chave: |
Clonagem molecular; Equine; Identification. |
|
Thesagro: |
Cavalo; Eqüino; Identificação; Método de Melhoramento; Polimorfismo Genético; Teste de Progênie. |
|
Thesaurus NAL: |
Breeding methods; Genetic polymorphism; Horses; Molecular cloning; Progeny testing. |
|
Categoria do assunto: |
-- |
|
URL: |
https://ainfo.cnptia.embrapa.br/digital/bitstream/AI-SEDE/18823/1/pab99_091.pdf
|
|
Marc: |
LEADER 01995naa a2200313 a 4500
001 1103540
005 2019-02-25
008 2000 bl uuuu u00u1 u #d
100 1 $aANUNCIACAO, C. E.
245 $aPaternity test in "mangalarga-marchador" equines by DNA-fingerprinting.
260 $c2000
500 $aTítulo em português: Teste de paternidade em eguinos Mangalarga-Marchador pela técnica do DNA 'fingerprinting".
520 $aGC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 105-fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
650 $aBreeding methods
650 $aGenetic polymorphism
650 $aHorses
650 $aMolecular cloning
650 $aProgeny testing
650 $aCavalo
650 $aEqüino
650 $aIdentificação
650 $aMétodo de Melhoramento
650 $aPolimorfismo Genético
650 $aTeste de Progênie
653 $aClonagem molecular
653 $aEquine
653 $aIdentification
700 1 $aASTOLFI FILHO, S.
773 $tPesquisa Agropecuária Brasileira, Brasília, DF$gv. 35, n. 10, p. 2007-15, out. 2000.
Download
Esconder MarcMostrar Marc Completo |
|
Registro original: |
Embrapa Unidades Centrais (AI-SEDE) |
|
|
Biblioteca |
ID |
Origem |
Tipo/Formato |
Classificação |
Cutter |
Registro |
Volume |
Status |
Fechar
|
| Expressão de busca inválida. Verifique!!! |
|
|
