|
|
Registros recuperados : 92 | |
6. | | BEZERRA, I. C.; RESENDE, R. de O.; POZZER, L.; NAGATA, T.; AVILA, A. C. de. Increase of tospoviral diversity in Brazil with the identification of two new tospovirus species, one from chrysanthemum and one from zucchini. Phytopathology, v.89, n.9, p.823-830, Sep. 1999. Biblioteca(s): Embrapa Hortaliças. |
| |
7. | | SANTOS, C. D. G.; AVILA, A. C. de; BEZERRA, I. C.; RESENDE, R. de O. Interacao geminivirus de tomate e Bemisia argentifolli: hospedeiros, aquisicao do virus, transmissao e deteccao no vetor. In: ENCONTRO LATINO-AMERICANO E DO CARIBE SOBRE MOSCAS BRANCAS E GEMINIVIRUS, 8., 1999, Recife, PE. Anais [e] mini-resumos... Recife: IPA, 1999. p.123. Resumo. Biblioteca(s): Embrapa Hortaliças. |
| |
10. | | FAJARDO, T. V. M.; AVILA, A. C. de; BUSO, J. A.; RESENDE, R. de O. Molecular characterization of garlic common latent virus(GCLV), a carlavirus, in garlic viral complex. Fitopatologia Brasileira, Brasilia, v.22, p.334, 1997. Suplemento. Resumo. Biblioteca(s): Embrapa Hortaliças. |
| |
11. | | FAJARDO, T. V. M.; AVILA, A. C. de; BUSO, J. A.; RESENDE, R. de O. Molecular characterization of garlic viral complex. Virus Reviews Research, Sao Paulo, v.2, n,1-2, p.191, nov. 1997. Resumo. Biblioteca(s): Embrapa Hortaliças. |
| |
15. | | MELO FILHO, P. de A.; DUSI, A. N.; COSTA, C. L.; RESENDE, R. de O. Colonização de plantas de alho por Neotoxoptera formosana no DF. Horticultura Brasileira, Brasília, DF, v. 23, n. 4, p. 929-930, out./dez. 2005. Biblioteca(s): Embrapa Hortaliças. |
| |
16. | | MELO FILHO, P. de A.; DUSI, A. N.; COSTA, C. L.; RESENDE, R. de O. Colonização de plantas de alho por Neotoxoptera formosana (Hemiptera: Aphidoidea) no Brasil. Horticultura Brasileira, Brasília, v. 21, n. 2, jul. 2003. Suplemento 2. Trabalho apresentado no 43º Congresso Brasileiro de Olericultura, 2003. Publicado também como resumo em: Horticultura Brasileira, Brasília, v. 21, n. 2, p. 413, jul. 2003. Suplemento 1. Biblioteca(s): Embrapa Hortaliças. |
| |
17. | | CUNHA, L. C. V. da; RESENDE, R, de O.; NAGATA, T.; INOUE-NAGATA, A. K. Distinct features of pepper yellow mosaic vírus isolates from tomato and sweetpepper. Brasília, Fitopatologia Brasileira, v. 29, n. 6, p. 663-667, maio/jun. 2004. Biblioteca(s): Embrapa Hortaliças. |
| |
Registros recuperados : 92 | |
|
|
Registro Completo
Biblioteca(s): |
Embrapa Unidades Centrais. |
Data corrente: |
02/05/2001 |
Data da última atualização: |
25/02/2019 |
Autoria: |
ANUNCIACAO, C. E.; ASTOLFI FILHO, S. |
Afiliação: |
CARLOS EDUARDO ANUNCIAÇÃO, Universidade Federal de Goiás - UFG/Departamento de Ciências Fisiológicas; SPARTACO ASTOLFI-FILHO, Universidade de Brasília - UnB/Departamento de Biologia Celular/Laboratório de Biologia Molecular. |
Título: |
Paternity test in "mangalarga-marchador" equines by DNA-fingerprinting. |
Ano de publicação: |
2000 |
Fonte/Imprenta: |
Pesquisa Agropecuária Brasileira, Brasília, DF, v. 35, n. 10, p. 2007-15, out. 2000. |
Idioma: |
Inglês |
Notas: |
Título em português: Teste de paternidade em eguinos Mangalarga-Marchador pela técnica do DNA 'fingerprinting". |
Conteúdo: |
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 105-fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively. |
Palavras-Chave: |
Clonagem molecular; Equine; Identification. |
Thesagro: |
Cavalo; Eqüino; Identificação; Método de Melhoramento; Polimorfismo Genético; Teste de Progênie. |
Thesaurus NAL: |
Breeding methods; Genetic polymorphism; Horses; Molecular cloning; Progeny testing. |
Categoria do assunto: |
-- |
URL: |
https://ainfo.cnptia.embrapa.br/digital/bitstream/AI-SEDE/18823/1/pab99_091.pdf
|
Marc: |
LEADER 01995naa a2200313 a 4500 001 1103540 005 2019-02-25 008 2000 bl uuuu u00u1 u #d 100 1 $aANUNCIACAO, C. E. 245 $aPaternity test in "mangalarga-marchador" equines by DNA-fingerprinting. 260 $c2000 500 $aTítulo em português: Teste de paternidade em eguinos Mangalarga-Marchador pela técnica do DNA 'fingerprinting". 520 $aGC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 105-fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively. 650 $aBreeding methods 650 $aGenetic polymorphism 650 $aHorses 650 $aMolecular cloning 650 $aProgeny testing 650 $aCavalo 650 $aEqüino 650 $aIdentificação 650 $aMétodo de Melhoramento 650 $aPolimorfismo Genético 650 $aTeste de Progênie 653 $aClonagem molecular 653 $aEquine 653 $aIdentification 700 1 $aASTOLFI FILHO, S. 773 $tPesquisa Agropecuária Brasileira, Brasília, DF$gv. 35, n. 10, p. 2007-15, out. 2000.
Download
Esconder MarcMostrar Marc Completo |
Registro original: |
Embrapa Unidades Centrais (AI-SEDE) |
|
Biblioteca |
ID |
Origem |
Tipo/Formato |
Classificação |
Cutter |
Registro |
Volume |
Status |
Fechar
|
Nenhum registro encontrado para a expressão de busca informada. |
|
|