| |
|
|
 | Acesso ao texto completo restrito à biblioteca da Embrapa Milho e Sorgo. Para informações adicionais entre em contato com cnpms.biblioteca@embrapa.br. |
|
Registro Completo |
|
Biblioteca(s): |
Embrapa Milho e Sorgo. |
|
Data corrente: |
07/11/2017 |
|
Data da última atualização: |
07/11/2017 |
|
Tipo da produção científica: |
Artigo em Periódico Indexado |
|
Autoria: |
TEIXEIRA, T. P. M.; PIMENTEL, L. D.; DIAS, L. A. dos S.; PARRELLA, R. A. da C.; PAIXÃO, M. Q. da; BIESDORF, E. M. |
|
Afiliação: |
Thaís Patrícia Moreira Teixeira, Universidade Federal de Viçosa; Leonardo Duarte Pimentel, Universidade Federal de Viçosa; Luiz Antônio dos Santos Dias, Universidade Federal de Viçosa; RAFAEL AUGUSTO DA COSTA PARRELLA, CNPMS; Mateus Queiroz da Paixão, Universidade Federal de Viçosa; Evandro Marcos Biesdorf, Universidade Federal de Viçosa. |
|
Título: |
Redefinition of sweet sorghum harvest time: new approach for sampling and decision-making in field. |
|
Ano de publicação: |
2017 |
|
Fonte/Imprenta: |
Industrial Crops and Products, v. 109, p. 579-586, 2017. |
|
DOI: |
10.1016/j.indcrop.2017.09.002 |
|
Idioma: |
Inglês |
|
Conteúdo: |
Sweet sorghum (Sorghum bicolor (L.) Moench) has been studied as an alternative raw material for ethanol production. A bottleneck of the crop is the determination of its harvest time in the field. Currently, stem maturation, measured through the Brix (soluble solids content) of intermediary internodes and the identification of grain maturity are used as harvest indicators. However, it is believed that this methodology is not suitable for this purpose, since these strategies have resulted in unsatisfactory industrial yields. The present work aimed to determine the ideal harvest time for sweet sorghum and identify which internode or segment of internodes better represents Brix of the stem juice. The experiment was conducted under field conditions, using the sweet sorghum cultivar BRS 511. It was set in a randomized block design with five replications and seven treatments. The treatments consisted in the sweet sorghum phenological stages, which were pre-flowering, flowering, milk dough, soft dough, mealy dough, hard dough and senescence. Were evaluated fresh (FBY) and dry biomass (DBY) yields, and moisture content (MC). It was quantified juice extraction (JE), juice yield (JY), tons of Brix per hectare (TBH) and total sugars in the juice (TS). Brix of the juice from each internode and from the whole stem (without segmenting the internodes = ?real? Brix) were evaluated. The highest Brix of stem juice (SB) was registered at the hard dough stage, with 16°Brix. The multiplicative index TBH, which combines SFBY, JE, SB and allows the estimation of sweet sorghum industrial yield, exhibited the highest value between the soft to hard dough stages, with an average of 9.40 t °Brix ha?1. Regarding the internodes, the highest Brix values were observed at the ones located at the stem middle-third. However, Brix measured in this section was not representative of Brix obtained from the whole stem. Regardless of the phenological stages, the internode number 2 was the only one whose Brix had not differed from the whole stem Brix (?real? Brix). Analyzing only the soft, mealy and hard dough stages (harvest prediction), Brix of the internodes 2 and 3 had not significantly differed from the stem real Brix. The sweet sorghum BRS 511 harvest time is comprehended between the soft to hard dough stages, in which were found the highest industrial yields parameters. For cultivar BRS 511, in field-Brix sampling could be used as a harvest indicator and it must be done at the internodes 2 and 3, which better represents the real Brix obtained from the whole stem. MenosSweet sorghum (Sorghum bicolor (L.) Moench) has been studied as an alternative raw material for ethanol production. A bottleneck of the crop is the determination of its harvest time in the field. Currently, stem maturation, measured through the Brix (soluble solids content) of intermediary internodes and the identification of grain maturity are used as harvest indicators. However, it is believed that this methodology is not suitable for this purpose, since these strategies have resulted in unsatisfactory industrial yields. The present work aimed to determine the ideal harvest time for sweet sorghum and identify which internode or segment of internodes better represents Brix of the stem juice. The experiment was conducted under field conditions, using the sweet sorghum cultivar BRS 511. It was set in a randomized block design with five replications and seven treatments. The treatments consisted in the sweet sorghum phenological stages, which were pre-flowering, flowering, milk dough, soft dough, mealy dough, hard dough and senescence. Were evaluated fresh (FBY) and dry biomass (DBY) yields, and moisture content (MC). It was quantified juice extraction (JE), juice yield (JY), tons of Brix per hectare (TBH) and total sugars in the juice (TS). Brix of the juice from each internode and from the whole stem (without segmenting the internodes = ?real? Brix) were evaluated. The highest Brix of stem juice (SB) was registered at the hard dough stage, with 16°Brix. The multiplicative in... Mostrar Tudo |
|
Thesagro: |
Colheita; Sorghum bicolor; Sorgo açucareiro. |
|
Categoria do assunto: |
F Plantas e Produtos de Origem Vegetal |
|
Marc: |
LEADER 03295naa a2200229 a 4500
001 2079034
005 2017-11-07
008 2017 bl uuuu u00u1 u #d
024 7 $a10.1016/j.indcrop.2017.09.002$2DOI
100 1 $aTEIXEIRA, T. P. M.
245 $aRedefinition of sweet sorghum harvest time$bnew approach for sampling and decision-making in field.$h[electronic resource]
260 $c2017
520 $aSweet sorghum (Sorghum bicolor (L.) Moench) has been studied as an alternative raw material for ethanol production. A bottleneck of the crop is the determination of its harvest time in the field. Currently, stem maturation, measured through the Brix (soluble solids content) of intermediary internodes and the identification of grain maturity are used as harvest indicators. However, it is believed that this methodology is not suitable for this purpose, since these strategies have resulted in unsatisfactory industrial yields. The present work aimed to determine the ideal harvest time for sweet sorghum and identify which internode or segment of internodes better represents Brix of the stem juice. The experiment was conducted under field conditions, using the sweet sorghum cultivar BRS 511. It was set in a randomized block design with five replications and seven treatments. The treatments consisted in the sweet sorghum phenological stages, which were pre-flowering, flowering, milk dough, soft dough, mealy dough, hard dough and senescence. Were evaluated fresh (FBY) and dry biomass (DBY) yields, and moisture content (MC). It was quantified juice extraction (JE), juice yield (JY), tons of Brix per hectare (TBH) and total sugars in the juice (TS). Brix of the juice from each internode and from the whole stem (without segmenting the internodes = ?real? Brix) were evaluated. The highest Brix of stem juice (SB) was registered at the hard dough stage, with 16°Brix. The multiplicative index TBH, which combines SFBY, JE, SB and allows the estimation of sweet sorghum industrial yield, exhibited the highest value between the soft to hard dough stages, with an average of 9.40 t °Brix ha?1. Regarding the internodes, the highest Brix values were observed at the ones located at the stem middle-third. However, Brix measured in this section was not representative of Brix obtained from the whole stem. Regardless of the phenological stages, the internode number 2 was the only one whose Brix had not differed from the whole stem Brix (?real? Brix). Analyzing only the soft, mealy and hard dough stages (harvest prediction), Brix of the internodes 2 and 3 had not significantly differed from the stem real Brix. The sweet sorghum BRS 511 harvest time is comprehended between the soft to hard dough stages, in which were found the highest industrial yields parameters. For cultivar BRS 511, in field-Brix sampling could be used as a harvest indicator and it must be done at the internodes 2 and 3, which better represents the real Brix obtained from the whole stem.
650 $aColheita
650 $aSorghum bicolor
650 $aSorgo açucareiro
700 1 $aPIMENTEL, L. D.
700 1 $aDIAS, L. A. dos S.
700 1 $aPARRELLA, R. A. da C.
700 1 $aPAIXÃO, M. Q. da
700 1 $aBIESDORF, E. M.
773 $tIndustrial Crops and Products$gv. 109, p. 579-586, 2017.
Download
Esconder MarcMostrar Marc Completo |
|
Registro original: |
Embrapa Milho e Sorgo (CNPMS) |
|
|
Biblioteca |
ID |
Origem |
Tipo/Formato |
Classificação |
Cutter |
Registro |
Volume |
Status |
URL |
Voltar
|
|
|
Registro Completo
|
Biblioteca(s): |
Embrapa Meio Ambiente. |
|
Data corrente: |
03/04/2017 |
|
Data da última atualização: |
21/07/2017 |
|
Tipo da produção científica: |
Resumo em Anais de Congresso |
|
Autoria: |
ZANOTTA, S.; TOFOLI, J. G.; SALAS, F. J. S.; TERÇARIOL, I. M. L.; DOMINGUES, R. J.; FERRARI, J. T.; RIVAS, E. B.; PRADO, S. de S.; SILVA, G. A. C.; MARCIANO, C. S.; HARAKAVA, R. |
|
Afiliação: |
S. ZANOTTA, IB; J. G. TOFOLI, IB; F. J. S. SALAS, IB; I. M. L. TERÇARIOL, IB; R. J. DOMINGUES, IB; J. T. FERRARI; E. B. RIVAS, IB; SIMONE DE SOUZA PRADO, CNPMA; G. A. C. SILVA, IB; C. S. MARCIANO, IB; IB. |
|
Título: |
Distribuição dos grupos de compatibilidade A1 e A2 de Phytophthora infestans nas regiões sul e sudeste do Brasil. |
|
Ano de publicação: |
2016 |
|
Fonte/Imprenta: |
In: CONGRESSO BRASILEIRO DE FITOPATOLOGIA, 49., 2016, Maceió. Anais... Maceió: Sociedade Brasileira de Fitopatologia, 2016. Ref. 586. |
|
Idioma: |
Português |
|
Conteúdo: |
A requeima, causada por Phytophthora infestans (Straminipila, Oomycota), é a doença mais destrutiva nas culturas de batata e tomate, podendo comprometer a produção em poucos dias. O patógeno é um organismo heterotálico, com dois grupos de compatibilidade A1 e A2, e reprodução assexuada ou sexuada, quando há o encontro de cepas compatíveis, A1 e A2, pelo contato de gametângios com a consequente formação de oósporos. Este trabalho teve como o objetivo monitorar a ocorrência de P. infestans, quanto ao grupo de compatibilidade, em áreas produtoras de batata e tomate das regiões Sul e Sudeste do Brasil. Foram coletadas 31 amostras nos estados de São Paulo, Paraná e Minas Gerais, durante 2015. As amostras foram colocadas em câmara úmida a 16°C com fotoperíodo de 12 h e, após cinco dias, foram observados os sinais do patógeno ao microscópio estereoscópico e óptico. A partir destas amostras foram realizados isolamentos em meio de cultura V8 com a adição de antibióticos e fungicidas. Para a identificação do grupo de compatibilidade de P. infestans, DNA total foi extraído das 31 amostras, submetidos a PCR com os iniciadores W16-1 (5?AACACGCACAAGGCATATAAATGTA -3?) e W16-2 (5?- GCGTAATGTAGCGTAACAGCTCTC -3?) e sequenciados. Trinta isolados de batata e tomate foram pertencentes ao grupo de compatibilidade A1, enquanto que o grupo de compatibilidade A2 foi detectado em apenas uma amostra de tomateiro proveniente do Estado de São Paulo. |
|
Palavras-Chave: |
Straminipila. |
|
Categoria do assunto: |
H Saúde e Patologia |
|
URL: |
https://ainfo.cnptia.embrapa.br/digital/bitstream/item/161617/1/zanotta.pdf
|
|
Marc: |
LEADER 02307nam a2200241 a 4500
001 2068002
005 2017-07-21
008 2016 bl uuuu u00u1 u #d
100 1 $aZANOTTA, S.
245 $aDistribuição dos grupos de compatibilidade A1 e A2 de Phytophthora infestans nas regiões sul e sudeste do Brasil.$h[electronic resource]
260 $aIn: CONGRESSO BRASILEIRO DE FITOPATOLOGIA, 49., 2016, Maceió. Anais... Maceió: Sociedade Brasileira de Fitopatologia, 2016. Ref. 586.$c2016
520 $aA requeima, causada por Phytophthora infestans (Straminipila, Oomycota), é a doença mais destrutiva nas culturas de batata e tomate, podendo comprometer a produção em poucos dias. O patógeno é um organismo heterotálico, com dois grupos de compatibilidade A1 e A2, e reprodução assexuada ou sexuada, quando há o encontro de cepas compatíveis, A1 e A2, pelo contato de gametângios com a consequente formação de oósporos. Este trabalho teve como o objetivo monitorar a ocorrência de P. infestans, quanto ao grupo de compatibilidade, em áreas produtoras de batata e tomate das regiões Sul e Sudeste do Brasil. Foram coletadas 31 amostras nos estados de São Paulo, Paraná e Minas Gerais, durante 2015. As amostras foram colocadas em câmara úmida a 16°C com fotoperíodo de 12 h e, após cinco dias, foram observados os sinais do patógeno ao microscópio estereoscópico e óptico. A partir destas amostras foram realizados isolamentos em meio de cultura V8 com a adição de antibióticos e fungicidas. Para a identificação do grupo de compatibilidade de P. infestans, DNA total foi extraído das 31 amostras, submetidos a PCR com os iniciadores W16-1 (5?AACACGCACAAGGCATATAAATGTA -3?) e W16-2 (5?- GCGTAATGTAGCGTAACAGCTCTC -3?) e sequenciados. Trinta isolados de batata e tomate foram pertencentes ao grupo de compatibilidade A1, enquanto que o grupo de compatibilidade A2 foi detectado em apenas uma amostra de tomateiro proveniente do Estado de São Paulo.
653 $aStraminipila
700 1 $aTOFOLI, J. G.
700 1 $aSALAS, F. J. S.
700 1 $aTERÇARIOL, I. M. L.
700 1 $aDOMINGUES, R. J.
700 1 $aFERRARI, J. T.
700 1 $aRIVAS, E. B.
700 1 $aPRADO, S. de S.
700 1 $aSILVA, G. A. C.
700 1 $aMARCIANO, C. S.
700 1 $aHARAKAVA, R.
Download
Esconder MarcMostrar Marc Completo |
|
Registro original: |
Embrapa Meio Ambiente (CNPMA) |
|
|
Biblioteca |
ID |
Origem |
Tipo/Formato |
Classificação |
Cutter |
Registro |
Volume |
Status |
Fechar
|
| Expressão de busca inválida. Verifique!!! |
|
|
