| |
|
|
| Registros recuperados : 1 | |
| 1. |  | LISI, C. S.; MARIA, V. B. R.; FERREIRA, L.; BOTOSSO, P. C.; VOIGT, A. R. A.; TOMAZELLO FILHO, M. Avaliação do incremento do tronco e da fenologia de árvores das reservas florestais de Ibicatu e de Santa Genebra, SP: resultados de 5 anos de observação. In: CONGRESSO DA SOCIEDADE BOTÂNICA DE SÃO PAULO, 16., 2006, Piracicaba. Mudanças climáticas e biodiversidade: resumos. Piracicaba: UNIMEP, 2006. 1 CD-ROM.| Biblioteca(s): Embrapa Florestas. |
|   |
| Registros recuperados : 1 | |
|
|
|
Registro Completo
|
Biblioteca(s): |
Embrapa Unidades Centrais. |
|
Data corrente: |
02/05/2001 |
|
Data da última atualização: |
25/02/2019 |
|
Autoria: |
ANUNCIACAO, C. E.; ASTOLFI FILHO, S. |
|
Afiliação: |
CARLOS EDUARDO ANUNCIAÇÃO, Universidade Federal de Goiás - UFG/Departamento de Ciências Fisiológicas; SPARTACO ASTOLFI-FILHO, Universidade de Brasília - UnB/Departamento de Biologia Celular/Laboratório de Biologia Molecular. |
|
Título: |
Paternity test in "mangalarga-marchador" equines by DNA-fingerprinting. |
|
Ano de publicação: |
2000 |
|
Fonte/Imprenta: |
Pesquisa Agropecuária Brasileira, Brasília, DF, v. 35, n. 10, p. 2007-15, out. 2000. |
|
Idioma: |
Inglês |
|
Notas: |
Título em português: Teste de paternidade em eguinos Mangalarga-Marchador pela técnica do DNA 'fingerprinting". |
|
Conteúdo: |
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 105-fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively. |
|
Palavras-Chave: |
Clonagem molecular; Equine; Identification. |
|
Thesagro: |
Cavalo; Eqüino; Identificação; Método de Melhoramento; Polimorfismo Genético; Teste de Progênie. |
|
Thesaurus NAL: |
Breeding methods; Genetic polymorphism; Horses; Molecular cloning; Progeny testing. |
|
Categoria do assunto: |
-- |
|
URL: |
https://ainfo.cnptia.embrapa.br/digital/bitstream/AI-SEDE/18823/1/pab99_091.pdf
|
|
Marc: |
LEADER 01995naa a2200313 a 4500
001 1103540
005 2019-02-25
008 2000 bl uuuu u00u1 u #d
100 1 $aANUNCIACAO, C. E.
245 $aPaternity test in "mangalarga-marchador" equines by DNA-fingerprinting.
260 $c2000
500 $aTítulo em português: Teste de paternidade em eguinos Mangalarga-Marchador pela técnica do DNA 'fingerprinting".
520 $aGC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 105-fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
650 $aBreeding methods
650 $aGenetic polymorphism
650 $aHorses
650 $aMolecular cloning
650 $aProgeny testing
650 $aCavalo
650 $aEqüino
650 $aIdentificação
650 $aMétodo de Melhoramento
650 $aPolimorfismo Genético
650 $aTeste de Progênie
653 $aClonagem molecular
653 $aEquine
653 $aIdentification
700 1 $aASTOLFI FILHO, S.
773 $tPesquisa Agropecuária Brasileira, Brasília, DF$gv. 35, n. 10, p. 2007-15, out. 2000.
Download
Esconder MarcMostrar Marc Completo |
|
Registro original: |
Embrapa Unidades Centrais (AI-SEDE) |
|
|
Biblioteca |
ID |
Origem |
Tipo/Formato |
Classificação |
Cutter |
Registro |
Volume |
Status |
Fechar
|
| Nenhum registro encontrado para a expressão de busca informada. |
|
|
